2026/9/14
Faezehossadat Abtahi

Faezehossadat Abtahi

Academic rank: Assistant Professor
ORCID: https://orcid.org/0000-0002-5170-082X
Education: PhD.
H-Index:
Faculty: Agriculture and Environment
ScholarId:
E-mail: f-abtahi [at] araku.ac.ir
ScopusId: View
Phone:
ResearchGate:

Research

Title
RT-PCR detection and identification of Fig Mosaic Virus (FMV)– Arak isolates
Type
Presentation
Keywords
Fig Mosaic Virus, Ficus carica, RT-PCR, Sequencing
Year
2018
Researchers Faezehossadat Abtahi ، Mehrnaz Hatami

Abstract

Common fig (Ficus carica L.) is a deciduous shrub with smooth white bark. Its leaves are deeply lobed with three or five lobes in the mulberry family. Figs can be eaten fresh or dried, and used in jam-making. It contain diverse phytochemicals, including polyphenols such as gallic acid, chlorogenic acid and syringic acid. Fig mosaic disease is recognized as economically important due to its worldwide occurrence and to premature fruit drop. Several viruses and viroids have been identified with this disease. Fig mosaic virus (FMV) is the type species of the genus Emaravirus in the family Bunyaviridae and is transmitted mainly by the eriophyid mite Aceria ficus. During autumn of 2016, a total number of 46 Common fig leaves with symptoms including mosaic and yellowing were collected from Arak. Total RNA was extracted using with Column RNA isolation kit (Denazist Asia, Iran) and were used in reverse transcription polymerase chain reaction (RT-PCR) using specific primer pair to amplify a partial sequence of glycoprotein (GP). Synthesis of cDNA was performed using FMV-GP-R (TATTACCTGGATCAACGCAG). cDNA product was subjected to PCR using 0.4 pmol of FMV-GP-R and FMV-GP-F (ACTTGCAAAGGCAGATGATA). A fragment with 700bp in length, in 12 samples was amplified. The amplified fragments were investigated in 1% agarose gel and were sequenced by Macrogene company. Nucleotide sequences of amplicons were compared with previously reported FMV from other countries using Blastn software available at GenBank, revealed the highest identity as 89-99% at nucleotide level and 85-92% at amino acid level.